Journal:

Article Title: In Cultured Oligodendrocytes the A/B-type hnRNP CBF-A Accompanies MBP mRNA Bound to mRNA Trafficking Sequences

doi: 10.1091/mbc.E07-10-1083

Figure Lengend Snippet: CBF-A, hnRNP A2, hnRNP A3, and hnRNP U are part of the same multiprotein complex. (A) Specificity of the affinity-purified peptide specific polyclonal anti-CBF-A antibody. Total protein extracts from HeLa cells were resolved by SDS-PAGE, blotted, and stained with Coomassie Blue (lane 1), immunostained with the CBF-A preimmune serum (lane 2), or with the affinity-purified anti-CBF-A antibody (lane 3) and with antibody SAK22 recognizing both CBF-A isoforms p37 and p42 (lane 4). (B) Sucrose gradient analysis of CBF-A, hnRNP A2, and hnRNP A3 from HeLa nuclear extracts. Fractions were resolved by SDS/PAGE and analyzed on immunoblots with antibodies to CBF-A and hnRNP A2/A3. (C) Schematic representation of recombinant hnRNP A2 and A3 and CBF-A constructs. (D) Pulldown experiment using S-tagged hnRNP A2, S-tagged hnRNP A3, or GST-tagged CBF-A constructs. The beads were incubated with HeLa nuclear extracts. Bound proteins were resolved by SDS PAGE, revealed by Coomassie staining and (E) analyzed on immunoblots with antibodies to CBF-A, hnRNP A2 and A3, and hnRNP U.

Article Snippet: Cloning, Expression, and Protein Purification Full-length hnRNP A2 (forward primer 5′-GGAATTCTTAGCGACTGAGTCCGCGATG, reverse primer 5′-ATAAGAATGCGGCCGCTGAAGCTGTTCTGTTACCTCTG) and hnRNP A3 ( Ma et al. , 2002 ) were cloned in pGEM-T (Promega, Madison, WI) and subsequently in pET30a (+) for expression (Novagen, Madison, WI).

Techniques: Affinity Purification, SDS Page, Staining, Western Blot, Recombinant, Construct, Incubation

Journal:

Article Title: In Cultured Oligodendrocytes the A/B-type hnRNP CBF-A Accompanies MBP mRNA Bound to mRNA Trafficking Sequences

doi: 10.1091/mbc.E07-10-1083

Figure Lengend Snippet: CBF-A binds the MBP mRNA RTS. (A) Sequences of wild-type (wtRTS) and scrambled RTS (scrRTS) used in this study. (B) Biotinylated wtRTS and scrRTS were conjugated to streptavidin Sepharose. Beads were incubated with HeLa nuclear, cytoplasmic, and high-salt protein extracts. Bound proteins were resolved by SDS-PAGE, revealed with Coomassie, and analyzed on immunoblots with antibodies to CBF-A and hnRNP A2 and A3. (C) RTS-binding assays using 33P-labeled wtRTS and scrRTS sequences. To perform EMSA, wtRTS and scrRTS probes were incubated with purified CBF-A and hnRNP A2 and A3 without affinity tags or (D) in the presence (+) or absence (−) of a 25-fold excess of unlabeled competitor RNA oligonucleotides as indicated. (E) Tissue distribution of CBF-A, analyzed on immunoblots, and normalized to the steady-state expression of histone H3.

Article Snippet: Cloning, Expression, and Protein Purification Full-length hnRNP A2 (forward primer 5′-GGAATTCTTAGCGACTGAGTCCGCGATG, reverse primer 5′-ATAAGAATGCGGCCGCTGAAGCTGTTCTGTTACCTCTG) and hnRNP A3 ( Ma et al. , 2002 ) were cloned in pGEM-T (Promega, Madison, WI) and subsequently in pET30a (+) for expression (Novagen, Madison, WI).

Techniques: Incubation, SDS Page, Western Blot, Binding Assay, Labeling, Purification, Expressing

Journal:

Article Title: In Cultured Oligodendrocytes the A/B-type hnRNP CBF-A Accompanies MBP mRNA Bound to mRNA Trafficking Sequences

doi: 10.1091/mbc.E07-10-1083

Figure Lengend Snippet: In cultured oligodendrocytes, CBF-A exhibits a granular cytoplasmic distribution which correlates with transported MBP mRNA. (A) Endogenous CBF-A (A–D and E–H) or (hnRNP A2 I–L and M–P) and MBP mRNA were simultaneously monitored by immuno-FISH and confocal microscopy. In D, arrows identify sites in which the distribution of CBF-A correlates with MBP RTS along processes. In E–H and M–P, oligodendrocyte processes are shown at approximately fivefold higher magnification. In H, arrowheads identify examples of CBF-A and MBP RTS-positive granules. In P, arrows point to examples of hnRNP A2- and MBP mRNA-positive granules. Scale bar, 20 μm. (B) Unbiased statistical quantification of individual CBF-A and MBP RTS-positive granules and (C) hnRNP A2 and MBP RTS-positive granules based on the immuno-FISH analysis. In both cases a linear correlation between the fluorescence intensity levels of CBF-A and RTS or hnRNP A2 and RTS is revealed.

Article Snippet: Cloning, Expression, and Protein Purification Full-length hnRNP A2 (forward primer 5′-GGAATTCTTAGCGACTGAGTCCGCGATG, reverse primer 5′-ATAAGAATGCGGCCGCTGAAGCTGTTCTGTTACCTCTG) and hnRNP A3 ( Ma et al. , 2002 ) were cloned in pGEM-T (Promega, Madison, WI) and subsequently in pET30a (+) for expression (Novagen, Madison, WI).

Techniques: Cell Culture, Confocal Microscopy, Fluorescence

Journal:

Article Title: In Cultured Oligodendrocytes the A/B-type hnRNP CBF-A Accompanies MBP mRNA Bound to mRNA Trafficking Sequences

doi: 10.1091/mbc.E07-10-1083

Figure Lengend Snippet: In oli-neu cells, the distribution of endogenous CBF-A correlates with hnRNP A2. (A and E) DAPI staining, (B and F) oli-neu cells stained with a mAb to hnRNP A2. (C and G) Oli-neu cells stained with the rabbit polyclonal peptide-specific anti-CBF-A antibody and (D and H) merged images. Scale bar, 20 μm. (B) Statistical quantification of CBF-A and hnRNP A2-positive granules based on the double immunofluorescence analysis and confocal microscopy in A. A linear correlation between the fluorescence signals of CBF-A and hnRNP A2 is revealed.

Article Snippet: Cloning, Expression, and Protein Purification Full-length hnRNP A2 (forward primer 5′-GGAATTCTTAGCGACTGAGTCCGCGATG, reverse primer 5′-ATAAGAATGCGGCCGCTGAAGCTGTTCTGTTACCTCTG) and hnRNP A3 ( Ma et al. , 2002 ) were cloned in pGEM-T (Promega, Madison, WI) and subsequently in pET30a (+) for expression (Novagen, Madison, WI).

Techniques: Staining, Immunofluorescence, Confocal Microscopy, Fluorescence

Journal:

Article Title: In Cultured Oligodendrocytes the A/B-type hnRNP CBF-A Accompanies MBP mRNA Bound to mRNA Trafficking Sequences

doi: 10.1091/mbc.E07-10-1083

Figure Lengend Snippet: CBF-A is associated with MBP mRNA in differentiating oligodendrocytes. (A) A complex containing CBF-A and hnRNP A2 is coprecipitated with the anti-CBF-A antibody from total protein extracts (Input) prepared from differentiating oli-neu cells in an RNA-dependent manner. Where indicated, extracts were treated with RNase A before immunoprecipitation. Bound proteins were resolved by SDS-PAGE and analyzed on immunoblots with antibodies to CBF-A and hnRNP A2. (B) qRT-PCR was performed on reverse-transcribed cDNA derived from RNA extracts of differentiating oli-neu cells, immunoprecipitated by CBF-A. The anti-CBF-A antibody leads to enrichment of MBP mRNA, as assessed with MBP-specific primers. Mock experiments and IgG pulldowns revealed negligible RNA enrichment. Input samples were considered to be 100%; thus all samples were divided by the inputs mean value. Data are presented as average of three independent experiments. Error bars, SEM. Importantly, in each case the percentages of immunoprecipitated mRNA are relative to the total amount of each individual mRNA species (input) analyzed.

Article Snippet: Cloning, Expression, and Protein Purification Full-length hnRNP A2 (forward primer 5′-GGAATTCTTAGCGACTGAGTCCGCGATG, reverse primer 5′-ATAAGAATGCGGCCGCTGAAGCTGTTCTGTTACCTCTG) and hnRNP A3 ( Ma et al. , 2002 ) were cloned in pGEM-T (Promega, Madison, WI) and subsequently in pET30a (+) for expression (Novagen, Madison, WI).

Techniques: Immunoprecipitation, SDS Page, Western Blot, Quantitative RT-PCR, Reverse Transcription, Derivative Assay

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Levels of Nrp1 and Nrp2 mRNA expression in freshly isolated Tw2+ cells vs Pax7+ cells, as determined by RNA-seq. (B) Western blot of NRP1 protein levels in cultured Tw2-derived myoblasts (Tw2-MB) and Pax7-derived myoblasts (Pax7-MB). GAPDH serves as a loading control. (C) Levels of Nrp1 and Nrp2 mRNA expression in Twist2-overexpressing Tw2-MB (Tw2-DM) and GFP-infected Tw2-MB (GFP-DM) after 4 days in differentiation medium, as determined by RNA-seq. (D) Genome browser shot of Twist2 binding at the Nrp1 promoter in both growth media (GM) and differentiation media (DM). (E) (Top panel) Co-immunostaining of Nrp1 (green), Twist2 (red), and Hoechst (blue) in adult mouse transverse section of quadriceps muscle. (Bottom panel) Zoomed in image of top panel. Scale: 50 µm. See also Figure S1

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Expressing, Isolation, RNA Sequencing Assay, Western Blot, Cell Culture, Derivative Assay, Infection, Binding Assay, Immunostaining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Overexpression of Nrp1 increases repulsion of Tw2-MB from Sema3a stripes. (Top) Control Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. (Bottom) Nrp1-overexpressing Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. (C) Overexpression of Nrp1 resulted in repulsion of Pax7-MB from Sema3a stripes. (Top) Control-infected Pax7-MB (red) were seeded on Sema3a stripes (green) and analyzed 1 day after seeding. (Bottom) Nrp1-overexpresssing Pax7-MB (red) were seeded on Sema3a stripes (green). Cells were analyzed 1 day after seeding and co-stained with Hoechst (blue). Scale bar: 100 µm. (D) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4C. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. **: p <0.005. See also Figure S4. Source data for 4B and 4C are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Over Expression, Staining, Infection

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Knockdown of Nrp1 by shRNA in Tw2-MB (red) abolished Sema3a avoidance. (Top) Control shRNA (shCtrl) infected Tw2-MB 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Tw2-MB overexpressing either shNrp1–1 or shNrp1–2 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. ***: p < 0.0005, ****: p < 0.00005. (C) Western blot showing loss of NRP1 protein in Tw2-MB infected with sgRNAs targeting Nrp1. GAPDH was used as a loading control. (D) (Top) Control pLentiCrisprV2-infected Tw2-MB (red) 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Two separate Nrp1 sgRNA-infected Tw2-MB (sgNrp1–2 and sgNrp1–5) 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (E) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5D. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. See also Figure S5. Source data for 5B and E are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: shRNA, Infection, Staining, Western Blot

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Experimental scheme for chimeric fusion assay. Tw2-MB were infected with retroviruses expressing shNrp1–2, control empty vector, or Nrp1, and mixed with primary myoblasts (SCs) infected with retroviruses expressing Sema3a-EGFP in equal numbers. Cells were then differentiated for 7 days. (B) SCs over-expressing Sema3a (green) were mixed with Tw2-MB (tdTO+) infected with Nrp1 (top), control empty vector (middle), or shNrp1–2 (bottom) retroviruses and differentiated for 7 days. Cells were fixed and stained with Hoechst (blue) and an antibody against fast myosin (MY32; white). Arrow indicates chimeric myotubes that are both Sema3a+ and tdTO+; * represents myotubes that Sema3a+ only; and arrowhead represents myotubes that are tdTO+ only. Scale bar: 50 µm. (C) Quantification of percent of nuclei in chimeric fibers for Figure 6B. Percent of nuclei in chimeric fibers was calculated as the percent of the number of nuclei in chimeric fibers over the total number of nuclei (red-only, green-only, and chimeric myofibers). Three fields per sample per experiment were quantified. Three separate experiments were performed. *: p < 0.05, **: p < 0.005. See also Figure S6. Source data for 6C is provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Single Vesicle Fusion Assay, Infection, Expressing, Plasmid Preparation, Staining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: KEY RESOURCE TABLE

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Recombinant, Isolation, Transgenic Assay, Software